Stem-loop sequence ssa-mir-18b

AccessionMI0026548 (change log)
DescriptionSalmo salar miR-18b stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   -----u    u    c   u    a   -  -aa u 
5'       aagg gcau uag gcag uag ug   g a
         |||| |||| ||| |||| ||| ||   |  
3'       uucc cgug auc cguc auc ac   c g
   acgguc    u    c   c    -   c  gac a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-18b-5p

Accession MIMAT0032434
Sequence

1 - 

uaaggugcaucuagugcagaua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-18b-3p

Accession MIMAT0032435
Sequence

43 - 

cugcccuacgugcuccuucuggca

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1