Stem-loop sequence ssa-mir-18a

AccessionMI0026547 (change log)
DescriptionSalmo salar miR-18a stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-18a
(4 sentences)

Stem-loop
   ----u    u   u    u     ua   aaau 
5'      aagg gca cuag guagu  gug    a
        |||| ||| |||| |||||  |||    g
3'      uucc cgu gauc cguca  uau    u
   cgguc    u   u    c     uc   gauc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-18a-5p

Accession MIMAT0032432
Sequence

1 - 

uaaggugcaucuaguguaguua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-18a-3p

Accession MIMAT0032433
Sequence

42 - 

acugcccuaguugcuccuucuggc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1