Stem-loop sequence ssa-mir-181c

AccessionMI0026542 (change log)
DescriptionSalmo salar miR-181c stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181c
(19 sentences)

Stem-loop
   --aa         cu           ug  g 
5'     cauucauug  gucgguggguu  au u
       |||||||||  |||||||||||  ||  
3'     guaaguaac  uagucacucaa  ua g
   acaa         --           ua  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181c-5p

Accession MIMAT0032425
Sequence

1 - 

aacauucauugcugucgguggg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181c-3p

Accession MIMAT0032426
Sequence

40 - 

ucacugaucaaugaaugaaca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1