Stem-loop sequence ssa-mir-181b

AccessionMI0026541 (change log)
DescriptionSalmo salar miR-181b stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181b
(7 sentences)

Stem-loop
   -aa         cug   c      ggacuc 
5'    cauucauug   ucg uggguu      u
      |||||||||   ||| ||||||       
3'    gugaguaac   agu acucga      g
   aac         --a   c      aaaagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181b-5p

Accession MIMAT0032423
Sequence

1 - 

aacauucauugcugucgcuggguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181b-3p

Accession MIMAT0032424
Sequence

41 - 

cucacugaacaaugagugcaa

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1