Stem-loop sequence ssa-mir-181a-5

AccessionMI0026540 (change log)
DescriptionSalmo salar miR-181a-5 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181a-5
(15 sentences)

Stem-loop
   --a   u      cu       a    gg    g 
5'    aca ucaacg  gucggug guuu  uaug a
      ||| ||||||  ||||||| ||||  |||| u
3'    ugu aguugc  cagcuac caaa  auac c
   ccg   c      --       -    -a    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181a-5p

Accession MIMAT0032417
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181a-5-3p

Accession MIMAT0032422
Sequence

44 - 

accaucgaccguugacugugcc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1