Stem-loop sequence ssa-mir-181a-4

AccessionMI0026539 (change log)
DescriptionSalmo salar miR-181a-4 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181a-4
(15 sentences)

Stem-loop
   --a          cu       a    -gag ua 
5'    acauucaacg  gucggug guuu    c  a
      ||||||||||  ||||||| ||||    |   
3'    ugugaguugc  cagcuac caaa    g  a
   cca          --       -    aaca uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181a-5p

Accession MIMAT0032417
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181a-4-3p

Accession MIMAT0032421
Sequence

43 - 

accaucgaccguugaguguacc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1