Stem-loop sequence ssa-mir-181a-3

AccessionMI0026538 (change log)
DescriptionSalmo salar miR-181a-3 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181a-3
(15 sentences)

Stem-loop
   --a   uu  ac          a    gagcc 
5'    aca  ca  gcugucggug guuu     u
      |||  ||  |||||||||| ||||     c
3'    ugu  gu  uggcagcuac caaa     u
   cca   cg  --          -    gacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181a-5p

Accession MIMAT0032417
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181a-3-3p

Accession MIMAT0032420
Sequence

43 - 

caucgacgguuggcuguacc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1