Stem-loop sequence ssa-mir-181a-2

AccessionMI0026537 (change log)
DescriptionSalmo salar miR-181a-2 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181a-2
(15 sentences)

Stem-loop
   --a   u      cu       a    gagcc 
5'    aca ucaacg  gucggug guuu     u
      ||| ||||||  ||||||| ||||     c
3'    ugu aguugc  cagcuac caaa     u
   cca   c      --       -    gacag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181a-5p

Accession MIMAT0032417
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181a-2-3p

Accession MIMAT0032419
Sequence

41 - 

accaucgaccguugacuguacc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1