Stem-loop sequence ssa-mir-181a-1

AccessionMI0026536 (change log)
DescriptionSalmo salar miR-181a-1 stem-loop
Gene family MIPF0000007; mir-181
Literature search

4 open access papers mention ssa-mir-181a-1
(15 sentences)

Stem-loop
   --a     c    cu       ag    ag a 
5'    acauu aacg  gucggug  uuug  c u
      ||||| ||||  |||||||  ||||  |  
3'    uguaa uugc  cagcuac  aaac  g c
   cca     a    --       ca    cu u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-181a-5p

Accession MIMAT0032417
Sequence

1 - 

aacauucaacgcugucggugagu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-181a-1-3p

Accession MIMAT0032418
Sequence

41 - 

accaucgaccguuaaauguacc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1