Stem-loop sequence ssa-mir-17-1

AccessionMI0026535 (change log)
DescriptionSalmo salar miR-17-1 stem-loop
Gene family MIPF0000001; mir-17
Literature search

2 open access papers mention ssa-mir-17-1
(9 sentences)

Stem-loop
   ----c         a  g     g   ucau 
5'      aaagugcuu ca ugcag uag    c
        ||||||||| || ||||| |||    u
3'      uuucacgga gu acguc auc    a
   acgaa         a  g     -   uaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-17-5p

Accession MIMAT0032414
Sequence

1 - 

caaagugcuuacagugcagguag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-17-3p

Accession MIMAT0032416
Sequence

38 - 

cugcagugaaggcacuuuaagca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1