Stem-loop sequence ssa-mir-16c

AccessionMI0026531 (change log)
DescriptionSalmo salar miR-16c stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -u        -  a        c  ga aaua 
5'   agcagcac gu aauauugg gu  g    c
     |||||||| || |||||||| ||  |     
3'   ucgucgug cg uuauaacc ca  c    a
   cu        u  a        c  gc ccag 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-16c-5p

Accession MIMAT0032410
Sequence

1 - 

uagcagcacguaaauauuggcg

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-16c-3p

Accession MIMAT0032411
Sequence

42 - 

cccaauauuagcugugcugcuuc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1