Stem-loop sequence ssa-mir-16b

AccessionMI0026530 (change log)
DescriptionSalmo salar miR-16b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -u        -  a        u  ga aau 
5'   agcagcac gu aauauugg gu  g   a
     |||||||| || |||||||| ||  |    
3'   ucgucgug cg uuauaacc ca  c   g
   cu        u  a        c  ac cca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-16b-5p

Accession MIMAT0032408
Sequence

1 - 

uagcagcacguaaauauuggug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-16b-3p

Accession MIMAT0032409
Sequence

40 - 

cccaauauuagcugugcugcuuc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1