Stem-loop sequence ssa-mir-16a-2

AccessionMI0026529 (change log)
DescriptionSalmo salar miR-16a-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   -         -  a          --    cc 
5'  uagcagcac gu aauauuggag  uuca  a
    ||||||||| || ||||||||||  ||||  c
3'  guugucgug ca uuaugaccuc  aagu  u
   a         g  g          cg    cg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-16a-5p

Accession MIMAT0032405
Sequence

1 - 

uagcagcacguaaauauuggag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-16a-2-3p

Accession MIMAT0032407
Sequence

41 - 

uccaguauugacggugcuguuga

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1