Stem-loop sequence ssa-mir-16a-1

AccessionMI0026528 (change log)
DescriptionSalmo salar miR-16a-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ssa-mir-16a-1
(1 sentences)

Stem-loop
   -          -ua          uuaaaacuacu  u 
5'  uagcagcacg   aauauuggag           gc g
    ||||||||||   ||||||||||           ||  
3'  gucgucgugc   uuaugaccuc           cg a
   a          uug          -----------  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-16a-5p

Accession MIMAT0032405
Sequence

1 - 

uagcagcacguaaauauuggag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-16a-3p

Accession MIMAT0032406
Sequence

44 - 

ccaguauuguucgugcugcuga

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1