Stem-loop sequence ssa-mir-15e

AccessionMI0026527 (change log)
DescriptionSalmo salar miR-15e stem-loop
Literature search

1 open access papers mention ssa-mir-15e
(1 sentences)

Stem-loop
   ----a          a          gguaa 
5'      agcagcacag augguuugug     u
        |||||||||| ||||||||||     a
3'      uugucguguc ugucggacau     c
   ugacg          a          aggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-15e-5p

Accession MIMAT0032403
Sequence

1 - 

aagcagcacagaaugguuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-15e-3p

Accession MIMAT0032404
Sequence

38 - 

caggcuguacugugcuguugcagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1