Stem-loop sequence ssa-mir-15d

AccessionMI0026526 (change log)
DescriptionSalmo salar miR-15d stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   ----ua         a          gg  a 
5'       gcagcacag augguuugug  uu c
         ||||||||| ||||||||||  || a
3'       cgucguguc ugccggacgu  ag c
   ugacgc         a          ag  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-15d-5p

Accession MIMAT0032401
Sequence

1 - 

uagcagcacagaaugguuugu

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-15d-3p

Accession MIMAT0032402
Sequence

38 - 

caggccguacugugcugccgcagu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1