Stem-loop sequence ssa-mir-15c-2

AccessionMI0026525 (change log)
DescriptionSalmo salar miR-15c-2 stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --u       c  c        aaa aaug 
5'    agcagcg au augguuug   c    u
      ||||||| || ||||||||   |    u
3'    ucgucgu ua uaccaagc   g    g
   auu       u  c        gug aaag 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-15c-5p

Accession MIMAT0032398
Sequence

1 - 

uagcagcgcaucaugguuuga

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-15c-2-3p

Accession MIMAT0032400
Sequence

40 - 

cgaaccaucauuugcugcuuua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1