Stem-loop sequence ssa-mir-15c-1

AccessionMI0026524 (change log)
DescriptionSalmo salar miR-15c-1 stem-loop
Gene family MIPF0000006; mir-15
Literature search

1 open access papers mention ssa-mir-15c-1
(3 sentences)

Stem-loop
   --u       c  c        aaa  gug  g 
5'    agcagcg au augguuug   ca   uu a
      ||||||| || ||||||||   ||   ||  
3'    ucgucgu ua uacuaagc   gu   ga a
   auu       u  c        ---  --a  a 
Get sequence
Confidence Annotation confidence: undefined
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-15c-5p

Accession MIMAT0032398
Sequence

1 - 

uagcagcgcaucaugguuuga

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-15c-3p

Accession MIMAT0032399
Sequence

40 - 

cgaaucaucauuugcugcuuua

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1