Stem-loop sequence ssa-mir-15b

AccessionMI0026523 (change log)
DescriptionSalmo salar miR-15b stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   --ua         c   u    c  guaucu 
5'     gcagcacau aug uuug ag      a
       ||||||||| ||| |||| ||       
3'     cgucgugua uac aaac uc      a
   ucgc         u   u    c  aacgaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-15b-5p

Accession MIMAT0032396
Sequence

1 - 

uagcagcacaucauguuuugc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-15b-3p

Accession MIMAT0032397
Sequence

41 - 

caaaucauuaugugcugccgcu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1