Stem-loop sequence ssa-mir-15a

AccessionMI0026522 (change log)
DescriptionSalmo salar miR-15a stem-loop
Gene family MIPF0000006; mir-15
Stem-loop
   c        a g            gugau 
5'  guagcagc c ucaugguuugua     a
    |||||||| | ||||||||||||     g
3'  cgucgucg g aguaccagacgu     u
   u        a a            agaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-15a-5p

Accession MIMAT0032394
Sequence

1 - 

cguagcagcacgucaugguuugu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-15a-3p

Accession MIMAT0032395
Sequence

40 - 

cagaccaugaagagcugcugcu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1