Stem-loop sequence ssa-mir-155-2

AccessionMI0026521 (change log)
DescriptionSalmo salar miR-155-2 stem-loop
Gene family MIPF0000157; mir-155
Literature search

2 open access papers mention ssa-mir-155-2
(18 sentences)

Stem-loop
   -        aau    a    ggu   g  guu 
5'  uuaaugcu   cgug uagg   ucu uu   a
    ||||||||   |||| ||||   ||| ||    
3'  gauuacga   guac aucc   aga aa   a
   c        -au    g    -ac   a  aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-155-5p

Accession MIMAT0032392
Sequence

1 - 

uuaaugcuaaucgugauaggggu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-155-3p

Accession MIMAT0032393
Sequence

44 - 

caccuagcauguaagcauuagc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1