Stem-loop sequence ssa-mir-146d-2

AccessionMI0026512 (change log)
DescriptionSalmo salar miR-146d-2 stem-loop
Gene family MIPF0000103; mir-146
Literature search

2 open access papers mention ssa-mir-146d-2
(4 sentences)

Stem-loop
   ---          a     a      u   u 
5'    ugagaacuga uucca ggguug auu c
      |||||||||| ||||| |||||| ||| u
3'    auucuugacu ggggu cccgac uga g
   caa          c     a      -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-146d-5p

Accession MIMAT0032376
Sequence

1 - 

ugagaacugaauuccaaggguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-146d-2-3p

Accession MIMAT0032378
Sequence

39 - 

cccauggggcucaguucuuaaac

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1