Stem-loop sequence ssa-mir-146d-1

AccessionMI0026511 (change log)
DescriptionSalmo salar miR-146d-1 stem-loop
Gene family MIPF0000103; mir-146
Literature search

2 open access papers mention ssa-mir-146d-1
(4 sentences)

Stem-loop
   --          a     a      u   u 
5'   ugagaacuga uucca ggguug auu c
     |||||||||| ||||| |||||| ||| u
3'   auucuugacu gaggu cccgac uga g
   ga          c     a      -   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-146d-5p

Accession MIMAT0032376
Sequence

1 - 

ugagaacugaauuccaaggguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-146d-3p

Accession MIMAT0032377
Sequence

39 - 

cccauggagcucaguucuuaag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1