Stem-loop sequence ssa-mir-146b

AccessionMI0026510 (change log)
DescriptionSalmo salar miR-146b stem-loop
Gene family MIPF0000103; mir-146
Literature search

2 open access papers mention ssa-mir-146b
(14 sentences)

Stem-loop
   --u     c   a           gua   g 
5'    gagaa uga guccauagaug   guu c
      ||||| ||| |||||||||||   ||| u
3'    uucuu acu cagguaucuac   uag c
   uuc     a   -           aga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-146b-5p

Accession MIMAT0032374
Sequence

1 - 

ugagaacugaaguccauagaugg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-146b-3p

Accession MIMAT0032375
Sequence

41 - 

aucuauggacucaauucuucuu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1