Stem-loop sequence ssa-mir-146a-3

AccessionMI0026509 (change log)
DescriptionSalmo salar miR-146a-3 stem-loop
Gene family MIPF0000103; mir-146
Literature search

3 open access papers mention ssa-mir-146a-3
(18 sentences)

Stem-loop
   -u           u         gua   g 
5'   gagaacugaau ccauagaug   guu c
     ||||||||||| |||||||||   ||| u
3'   uucuugacuua gguaucuac   uag c
   uc           -         aga   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-146a-5p

Accession MIMAT0032371
Sequence

1 - 

ugagaacugaauuccauagaugg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-146a-3-3p

Accession MIMAT0032373
Sequence

41 - 

aucuauggauucaguucuucu

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1