Stem-loop sequence ssa-mir-146a-2

AccessionMI0026508 (change log)
DescriptionSalmo salar miR-146a-2 stem-loop
Gene family MIPF0000103; mir-146
Literature search

3 open access papers mention ssa-mir-146a-2
(18 sentences)

Stem-loop
   ---u         au          gu g  a 
5'     gagaacuga  uccauagaug  g cu c
       |||||||||  ||||||||||  | || u
3'     uucuugacu  ggguaucuac  u ga g
   gguc         -c          ug a  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-146a-5p

Accession MIMAT0032371
Sequence

1 - 

ugagaacugaauuccauagaugg

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-146a-3p

Accession MIMAT0032372
Sequence

41 - 

aucuaugggcucaguucuucugg

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1