Stem-loop sequence ssa-mir-145-2

AccessionMI0026506 (change log)
DescriptionSalmo salar miR-145-2 stem-loop
Gene family MIPF0000079; mir-145
Literature search

2 open access papers mention ssa-mir-145-2
(4 sentences)

Stem-loop
   -- uc    u  c             gg ca 
5'   g  cagu uu ccaggaaucccuu  g  a
     |  |||| || |||||||||||||  |   
3'   c  guca aa gguccuuaggggg  c  u
   uu uu    u  a             aa ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-145-5p

Accession MIMAT0032369
Sequence

1 - 

guccaguuuucccaggaaucccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-145-3p

Accession MIMAT0032370
Sequence

42 - 

auuccuggaaauacuguucuu

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1