Stem-loop sequence ssa-mir-145-1

AccessionMI0026505 (change log)
DescriptionSalmo salar miR-145-1 stem-loop
Gene family MIPF0000079; mir-145
Literature search

2 open access papers mention ssa-mir-145-1
(4 sentences)

Stem-loop
   -- uc    u  c            -ug gca 
5'   g  cagu uu ccaggaaucccu   g   a
     |  |||| || ||||||||||||   |    
3'   c  guca aa gguccuuagggg   c   u
   uu uu    u  a            caa aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-145-5p

Accession MIMAT0032369
Sequence

1 - 

guccaguuuucccaggaaucccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-145-3p

Accession MIMAT0032370
Sequence

43 - 

auuccuggaaauacuguucuu

 - 63

Get sequence
Evidence experimental; Illumina [1]

References

1