Stem-loop sequence ssa-mir-144

AccessionMI0026504 (change log)
DescriptionSalmo salar miR-144 stem-loop
Gene family MIPF0000093; mir-144
Literature search

2 open access papers mention ssa-mir-144
(6 sentences)

Stem-loop
   gg        a         a  -   uu 
5'   auaucauc uauacugua gu ucg  a
     |||||||| ||||||||| || |||   
3'   uguaguag auaugacau ca agu  u
   ca        -         -  c   gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-144-5p

Accession MIMAT0032367
Sequence

1 - 

ggauaucaucauauacuguaaguu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-144-3p

Accession MIMAT0032368
Sequence

38 - 

cuacaguauagaugauguac

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1