Stem-loop sequence ssa-mir-140

AccessionMI0026499 (change log)
DescriptionSalmo salar miR-140 stem-loop
Gene family MIPF0000085; mir-140
Literature search

2 open access papers mention ssa-mir-140
(7 sentences)

Stem-loop
   -ca             a       uu   uc 
5'    gugguuuuacccu ugguagg  acg  a
      ||||||||||||| |||||||  |||   
3'    caccaagauggga accaucu  ugu  u
   agg             c       --   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-140-5p

Accession MIMAT0032359
Sequence

1 - 

cagugguuuuacccuaugguag

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-140-3p

Accession MIMAT0032360
Sequence

40 - 

uaccacaggguagaaccacgga

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1