Stem-loop sequence ssa-mir-137-1

AccessionMI0026491 (change log)
DescriptionSalmo salar miR-137-1 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention ssa-mir-137-1
(6 sentences)

Stem-loop
   --   g       ug   u       ca a 
5'   acg guauucu  ggu gauaaua  g u
     ||| |||||||  ||| |||||||  |  
3'   ugc cauaaga  ucg uuauugu  c g
   ga   g       gu   -       ag u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-137-5p

Accession MIMAT0032350
Sequence

1 - 

acggguauucuuggguugauaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-137-3p

Accession MIMAT0032351
Sequence

37 - 

uuauugcuugagaauacgcguag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1