Stem-loop sequence ssa-mir-135c-1

AccessionMI0026489 (change log)
DescriptionSalmo salar miR-135c-1 stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   ua        u             g  a 
5'   uggcuuuu auuccuacgugag au g
     |||||||| ||||||||||||| ||  
3'   accgaaga uagggauguacuu ug a
   uc        -             g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-135c-5p

Accession MIMAT0032348
Sequence

1 - 

uauggcuuuuuauuccuacguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-135c-3p

Accession MIMAT0032349
Sequence

38 - 

auguagggauagaagccacu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1