Stem-loop sequence ssa-mir-135b-3

AccessionMI0026488 (change log)
DescriptionSalmo salar miR-135b-3 stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention ssa-mir-135b-3
(1 sentences)

Stem-loop
   -u        cuau           uuuu 
5'   auggcuuu    uccuaugugau    u
     ||||||||    |||||||||||     
3'   uaccgaaa    gggauacacug    c
   gu        -ccu           ucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-135b-5p

Accession MIMAT0032344
Sequence

1 - 

uauggcuuucuauuccuauguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-135b-3-3p

Accession MIMAT0032347
Sequence

38 - 

acauaggguccaaagccauug

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1