Stem-loop sequence ssa-mir-135b-1

AccessionMI0026486 (change log)
DescriptionSalmo salar miR-135b-1 stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention ssa-mir-135b-1
(1 sentences)

Stem-loop
   -u        cuau           --u  u 
5'   auggcuuu    uccuaugugau   uc c
     ||||||||    |||||||||||   || u
3'   uaccgaaa    gggauguacug   gg c
   gu        -uuu           uau  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-135b-5p

Accession MIMAT0032344
Sequence

1 - 

uauggcuuucuauuccuauguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-135b-1-3p

Accession MIMAT0032345
Sequence

40 - 

cauguaggguuuaaagccauug

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1