Stem-loop sequence ssa-mir-135a

AccessionMI0026485 (change log)
DescriptionSalmo salar miR-135a stem-loop
Gene family MIPF0000028; mir-135
Literature search

1 open access papers mention ssa-mir-135a
(5 sentences)

Stem-loop
   --          u        c   c g g 
5'   uauggcuuuu auuccuau uga u c u
     |||||||||| |||||||| ||| | | u
3'   guaccgaagg uagggaua acu g g g
   ac          -        u   u g a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-135a-5p

Accession MIMAT0032342
Sequence

1 - 

uauggcuuuuuauuccuaucuga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-135a-3p

Accession MIMAT0032343
Sequence

40 - 

uauagggauggaagccaugca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1