Stem-loop sequence ssa-mir-1338

AccessionMI0026479 (change log)
DescriptionSalmo salar miR-1338 stem-loop
Gene family MIPF0000805; mir-1388
Literature search

2 open access papers mention ssa-mir-1338
(9 sentences)

Stem-loop
   --a  a   u c         a  -  gac 
5'    gg cug c aaccugaga ug gu   u
      || ||| | ||||||||| || ||    
3'    cc gac g uuggacucu ac cg   u
   gua  c   u c         a  u  gau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-1338-5p

Accession MIMAT0032335
Sequence

1 - 

aggacuguccaaccugagaau

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-1338-3p

Accession MIMAT0032336
Sequence

38 - 

aucucagguucgucagcccaug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1