Stem-loop sequence ssa-mir-125b-3

AccessionMI0026456 (change log)
DescriptionSalmo salar miR-125b-3 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ssa-mir-125b-3
(9 sentences)

Stem-loop
   --uc  ug  ac     a         acu 
5'     cc  ag  ccuua ccugugacu   u
       ||  ||  ||||| |||||||||    
3'     gg  uc  ggagu ggacacugg   u
   acaa  gu  ca     -         aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-125b-5p

Accession MIMAT0032307
Sequence

1 - 

ucccugagacccuuaaccuguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-125b-3-3p

Accession MIMAT0032310
Sequence

38 - 

acaggugaggaccuugggaaca

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1