Stem-loop sequence ssa-mir-125b-2

AccessionMI0026455 (change log)
DescriptionSalmo salar miR-125b-2 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ssa-mir-125b-2
(9 sentences)

Stem-loop
   -uc  ug  ac     a         ac 
5'    cc  ag  ccuua ccugugauu  u
      ||  ||  ||||| |||||||||  u
3'    gg  uc  ggagu ggacacuag  c
   caa  gu  cu     -         aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-125b-5p

Accession MIMAT0032307
Sequence

1 - 

ucccugagacccuuaaccuguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-125b-2-3p

Accession MIMAT0032309
Sequence

38 - 

caggugagguccuugggaac

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1