Stem-loop sequence ssa-mir-125b-1

AccessionMI0026454 (change log)
DescriptionSalmo salar miR-125b-1 stem-loop
Gene family MIPF0000033; mir-10
Literature search

3 open access papers mention ssa-mir-125b-1
(12 sentences)

Stem-loop
   uc      ac     a       gg  au 
5'   ccugag  ccuua ccuguga  uc  a
     ||||||  ||||| |||||||  ||   
3'   gggcuc  ggagu ggacacu  gg  g
   aa      cu     -       --  au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-125b-5p

Accession MIMAT0032307
Sequence

1 - 

ucccugagacccuuaaccuguga

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-125b-1-3p

Accession MIMAT0032308
Sequence

38 - 

acaggugagguccucgggaa

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1