Stem-loop sequence ssa-mir-106b

AccessionMI0026440 (change log)
DescriptionSalmo salar miR-106b stem-loop
Gene family MIPF0000001; mir-17
Literature search

1 open access papers mention ssa-mir-106b
(4 sentences)

Stem-loop
   ----aa         c g        gu   gau 
5'       aagugcuua a ugcaggua  ggc   g
         ||||||||| | ||||||||  |||    
3'       uucacgagu u acguccau  ccg   c
   acuuuc         a g        --   acc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-106b-5p

Accession MIMAT0032288
Sequence

1 - 

aaaagugcuuacagugcaggua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-106b-3p

Accession MIMAT0032289
Sequence

41 - 

ccugcaguaugagcacuucuuuca

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1