Stem-loop sequence ssa-mir-106a-1

AccessionMI0026438 (change log)
DescriptionSalmo salar miR-106a-1 stem-loop
Gene family MIPF0000001; mir-17
Stem-loop
   ---ua           g   a    au   uau 
5'      aagugcuuaca ugc ggua  ggu   g
        ||||||||||| ||| ||||  |||    
3'      uucacgagugu acg ccau  cca   u
   cuguc           a   -    --   ucc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-106a-5p

Accession MIMAT0032286
Sequence

1 - 

uaaagugcuuacagugcaggua

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-106a-3p

Accession MIMAT0032287
Sequence

41 - 

ccgcaaugugagcacuucuguc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1