Stem-loop sequence ssa-mir-101b-2

AccessionMI0026436 (change log)
DescriptionSalmo salar miR-101b-2 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention ssa-mir-101b-2
(3 sentences)

Stem-loop
   --               cg     g  ug 
5'   caguuaucaugguac  gugcu ug  c
     |||||||||||||||  ||||| ||  c
3'   gucaauaguaucaug  cauga ac  u
   aa               -a     -  ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-101b-5p

Accession MIMAT0032282
Sequence

1 - 

caguuaucaugguaccggugcugu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-101b-3p

Accession MIMAT0032283
Sequence

37 - 

uacaguacuaugauaacugaa

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1