Stem-loop sequence ssa-mir-101a-1

AccessionMI0026433 (change log)
DescriptionSalmo salar miR-101a-1 stem-loop
Gene family MIPF0000046; mir-101
Literature search

1 open access papers mention ssa-mir-101a-1
(6 sentences)

Stem-loop
   --           u      a    gucca 
5'   ucaguuaucac gugcug ugcu     u
     ||||||||||| |||||| ||||      
3'   agucaauagug caugac augg     c
   ga           u      -    aaauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-miR-101a-5p

Accession MIMAT0032280
Sequence

1 - 

ucaguuaucacugugcugaugcu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-miR-101a-3p

Accession MIMAT0032281
Sequence

38 - 

uacaguacugugauaacugaag

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1