Stem-loop sequence ssa-let-7i-1

AccessionMI0026429 (change log)
DescriptionSalmo salar let-7i-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7i-1
(5 sentences)

Stem-loop
   --u        a        u   --------  u     ug   
5'    gagguagu guuugugc guu        gg cgggu  ug 
      |||||||| |||||||| |||        || |||||  | a
3'    uuccauca caaacgcg caa        uc guccg  ac 
   ccg        g        u   uagaggug  -     gu   
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7i-5p

Accession MIMAT0032274
Sequence

1 - 

ugagguaguaguuugugcuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7i-3p

Accession MIMAT0032275
Sequence

57 - 

cugcgcaaacgacuaccuugcc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1