Stem-loop sequence ssa-let-7g-1

AccessionMI0026426 (change log)
DescriptionSalmo salar let-7g-1 stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7g-1
(5 sentences)

Stem-loop
   --u   gu     u          ----uua     ac 
5'    gag  aguag uuguauaguu       ggauc  a
      |||  ||||| ||||||||||       |||||   
3'    uuc  ucauc gacauaucag       ucuag  c
   ccu   ug     u          uagaggg     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7g-5p

Accession MIMAT0032270
Sequence

1 - 

ugagguaguaguuuguauaguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7g-3p

Accession MIMAT0032271
Sequence

51 - 

cuauacagucuacugucuuucc

 - 72

Get sequence
Evidence experimental; Illumina [1]

References

1