Stem-loop sequence ssa-let-7f

AccessionMI0026425 (change log)
DescriptionSalmo salar let-7f stem-loop
Gene family MIPF0000002; let-7
Literature search

2 open access papers mention ssa-let-7f
(5 sentences)

Stem-loop
   --u                 u     ---------       u 
5'    gagguaguagauuguau guugu         gggguag g
      ||||||||||||||||| |||||         ||||||| a
3'    uuccguuaucuaacaua caaua         ucccauu u
   ccc                 u     gaagacuag       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ssa-let-7f-5p

Accession MIMAT0032268
Sequence

1 - 

ugagguaguagauuguauuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ssa-let-7f-3p

Accession MIMAT0032269
Sequence

57 - 

cuauacaaucuauugccuuccc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1