Stem-loop sequence hsa-mir-8071-2

AccessionMI0026417 (change log)
Symbol HGNC:MIR8071-2
DescriptionHomo sapiens miR-8071 stem-loop
Gene family MIPF0001799; mir-8071
Stem-loop
   cg     --  g     gg  cu   -     u 
5'   gccac  au gccca  cu  ucu ccgag g
     |||||  || |||||  ||  ||| |||||  
3'   cggug  ug ugggu  gg  agg ggcuc a
   ga     ga  g     ga  uc   u     u 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 105640168-105640232 [+]
antisense
OTTHUMT00000409296 ; RP11-44N21.4-001; intron 1
OTTHUMT00000074544 ; NUDT14-001; intron 4
ENST00000548203 ; RP11-44N21.4-001; intron 1
ENST00000392568 ; NUDT14-001; intron 4
Database links

Mature sequence hsa-miR-8071

Accession MIMAT0030998
Sequence

36 - 

cgguggacuggagugggugg

 - 55

Get sequence
Deep sequencing10 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23612084 "Characterization and Identification of novel serum microRNAs in sepsis patients with different outcomes" Wang HJ, Zhang PJ, Chen WJ, Jie D, Dan F, Jia YH, Xie LX Shock. 39:480-487(2013).