Stem-loop sequence cpa-MIR535

AccessionMI0026376
DescriptionCarica papaya miR535 stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   --         g g             uau  c    ccg 
5'   ugacaacga a agagcacgcuugu   ca ucau   a
     ||||||||| | |||||||||||||   || ||||   g
3'   acuguugcu u ucucgugcgggca   gu agua   g
   au         g a             ugu  u    uau 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?

Mature sequence cpa-miR535

Accession MIMAT0031824
Sequence

1 - 

ugacaacgagagagagcacgc

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23216749 "Asymmetric purine-pyrimidine distribution in cellular small RNA population of papaya" Aryal R, Yang X, Yu Q, Sunkar R, Li L, Ming R BMC Genomics. 13:682(2012).