Stem-loop sequence cpa-MIR396

AccessionMI0026374 (change log)
DescriptionCarica papaya miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention cpa-MIR396
(10 sentences)

Stem-loop
   --            c          ug   u    -     g 
5'   uuccacagcuuu uugaacugca  auc guau uagga a
     |||||||||||| ||||||||||  ||| |||| ||||| a
3'   agggugucgaaa aacuuggcgu  uag uaua gucuu a
   ga            u          --   c    u     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cpa-miR396

Accession MIMAT0031822
Sequence

1 - 

uuccacagcuuucuugaacug

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23216749 "Asymmetric purine-pyrimidine distribution in cellular small RNA population of papaya" Aryal R, Yang X, Yu Q, Sunkar R, Li L, Ming R BMC Genomics. 13:682(2012).