Stem-loop sequence bma-mir-84-2

AccessionMI0026317 (change log)
DescriptionBrugia malayi miR-84-2 stem-loop
Gene family MIPF0000250; mir-84
Literature search

1 open access papers mention bma-mir-84-2
(3 sentences)

Stem-loop
   ---uuu   aau     --     u cu           uaaag   c   agca 
5'       uca   ugcaa  gaggc g  gagguaguuua     cug gag    g
         |||   |||||  ||||| |  |||||||||||     ||| |||    a
3'       agu   auguu  uuccg c  cucuaucgaau     gac cuc    u
   uuucuu   ---     au     u ac           -uuua   a   auac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold192: 9573-9676 [+]
intergenic
Database links

Mature sequence bma-miR-84-5p

Accession MIMAT0031761
Sequence

23 - 

ugagguaguuuauaaagcugcga

 - 45

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).